A Brief History of Everyone Who Ever Lived by Rutherford and Mukherjee
Ref: Rutherford & Mukherjee (2016). A Brief History of Everyone Who Ever Lived: The Human story retold through our genes. W&N Publishing.
______________________________________________________________________________
Summary
The history of the evolution of Homo sapiens from Hominids and the great apes as told through paleogenetics.
Life is transition: Your parents had parents, and theirs had parents, and so on, two by two, back through the whole of history, and prehistory. If you keep going back and back, your ancestors will slowly and inevitably become unrecognizable to you, via apes and monkeys, two-legged then quadrupedal, and ratty mammals and brutish beasts on land, and before them in wading sea creatures and fishy swimmers, and worms and weedy sea plants, and around two billion years ago, you don’t even need two parents, but just the binary fission of a single cell, one becomes two. Eventually, at the beginning of life on Earth around 4 ba, you’re locked in a rock at the bottom of the oceans, inside the hot bubbling tumult of a hydrothermal vent.
You have acquired through nothing other than chance at least 100 mutations that are unique to you.
The Human Genome is split into ~20,000 genes which are all constructed with DNA. DNA encodes RNA which creates proteins that carry out every single process in the human body.
No one will ever find a gene for “evil,” or for beauty, or for musical genius, or for scientific genius, because they don’t exist. DNA is not destiny. The presence of a particular variant of a particular gene may just have the effect of altering the odds of any particular behavior. More likely, the possession of many slight differences in many genes will have an effect on the likelihood of a particular characteristic, in consort with your environment, which includes all things that are not DNA.
The number of diseases that have been eradicated as a result of our knowing the genome? Zero. The number of diseases that have been cured as a result of gene therapy? Zero.
______________________________________________________________________________
Misc Quotes
Forer Effect: a psychological phenomenon where people conclude that broadly true statements are accurate for themselves personally, when they are in fact generically true for many people.
“Travel is fatal to prejudice, bigotry, and narrow-mindedness.”-Mark Twain, 1869.
“We are naturally plagued by the tyranny of a discontinuous mind.”-Richard Dawkins.
"Ignorance more frequently begets confidence than does knowledge."-Darwin.
“We shall not cease from exploration And the end of all our exploring Will be to arrive where we started And know the place for the first time.”-T. S. Eliot, Little Gidding.
The simple deterministic version of genetics is merely a new phrenology.
______________________________________________________________________________
Scientific Analysis
Doubt is the cornerstone of science. It gives you a sure footing from which to build an argument based on data.
Science is a process that strives to excise our limited view of the universe and our inbuilt prejudices from understanding an objective reality. Things are often not as they appear to us, but we invented and developed the scientific process to correct our subjective failings: Data is king.
“It is well recognized” is one of those phrases that make me a bit twitchy. When I read that in a scientific journal, in my head I translate it to “we couldn’t find a reference for this”: It might be true, but it’s difficult to substantiate.
Do not fall into the tempting trap of mistaking absence of evidence for evidence of absence.
Meta-Analysis: A powerful way of aggregating multiple studies to ramp up the analytical depth.
They know that what they think is true, and in science we must assume we are wrong. We know that we doubt everything we know is correct.
______________________________________________________________________________
Ecology
Species: Two species are defined as distinct when they are incapable of producing fertile offspring together.
Type specimen: the DNA profile that defines the species, against which all are subsequently compared.
Evolution: The accumulation of genetic change over time that forms new species.
As long as humans keep having sex and that sex results in more humans, then we are evolving.
This release that we have invented from the harshness of nature means that evolution with selection is likely to have radically slowed, though not stopped.
______________________________________________________________________________
Hominids
Domain: Eukaryota (complex life)
Kingdom: Animalia (animals)
Phylum: Chordata (animals with a central column, akin to a backbone)
Class: Mammalia (milk producing)
Order: Primates (monkeys, apes, tarsiers, and a few more)
Suborder: Haplorhini (dry-nosed apes)
Family: Hominidae (great apes)
Genera:
Pan (chimps and bonobos): 24 pairs of chromosomes.
Pongo (orangutans): 24 pairs of chromosomes.
Gorilla (gorillas): 24 pairs of chromosomes.
Homo (us): 23 pairs of chromosomes. The discrepancy between homo and the other great apes is found in our chromosome 2—the second largest single chunk of DNA we carry. It’s such a whopper because it is an end-to-end fusion of two chromosomes found in chimps, orangs, and gorillas. We know this because the genes on the two hairy ape chromosomes are effectively the same and in the same order as those found on our chromosome 2.
Ontological discontinuity: if we were looking for a moment where the metaphorical breath of God metaphorically entered us, then it could be when those two chromosomes fused.
Denisovan DNA is alive and well in contemporary Melanesians—the indigenous people of Fiji, Papua New Guinea, and a scattering of islands off the northeast coast of Australia. Just as the Neanderthals left their permanent mark in me and you if you are of Eurasian descent, these other people, known only from this single bone, imprinted their genetic mark through the ages in the ancestors of these island people, up to 5% of their genomes.
______________________________________________________________________________
Human Ancestry
~107 billion modern humans have ever existed.
We only have to go back a few dozen centuries to see that most of the 7 billion of us alive today are descended from a tiny handful of people, the population of a village.
Even if you live in the most remote parts of the Hebrides, or the edge of the Greek Aegean, we share an ancestor only a few hundred years ago. A thousand years ago, we Europeans share all of our ancestry. Triple that time and we share all our ancestry with everyone on Earth. We are all cousins, of some degree. I find this pleasing, a warm light for all mankind to share. Our DNA threads through all of us.
You are of royal descent, because everyone is. You are of Viking descent, because everyone is. You are of Saracen, Roman, Goth, Hun, Jewish descent, because, well, you get the idea. All Europeans are descended from exactly the same people, and not that long ago. Everyone alive in the tenth century who left descendants is the ancestor of every living European today, including Charlemagne, and his children Drogo, Pippin, and, of course, not forgetting Hugh. If you’re broadly eastern Asian, you’re almost certain to have Genghis Kahn sitting atop your tree somewhere in the same manner, as is often claimed. If you’re a human being on Earth, you almost certainly have Nefertiti, Confucius, or anyone we can actually name from ancient history in your tree, if they left children. The further back we go, the more the certainty of ancestry increases, though the knowledge of our ancestors decreases. It is simultaneously wonderful, trivial, meaningless, and fun.
______________________________________________________________________________
Reproduction
The sperm that made you started its life in your father’s testicles within a few days before your conception. One single sperm out of a spurt of billions ground its head against your mother’s egg, one of just a few hundred.
Twins come in two types:
Monozygotic: identical, as very early in development following fertilization, the embryo divides but separates, leaving two genetically identical bundles of cells, each destined to grow into a child.
Dizygotic: the result of two eggs being fertilized simultaneously, and so are no more genetically similar than siblings; they just happen to share a womb.
Heritability: a measure of how much of the differences we see in a population can be accounted for by genetics, and how much is determined by the environment.
We know that height is highly heritable. Dozens of studies over a century have shown that the vast majority of differences in height in a given population are down to genes, and only a small proportion due to the environment. If the tallest person in a population is seven foot, and the shortest five, there’s a twenty-four-inch difference. Approximately twenty-two of those inches are the result of genetic differences. Tens of thousands of people have been inputted into GWAS analysis, which has revealed plenty of alleles that stand out as relevant. But, in total, when you add up the contribution that each seems to make to height, it only comes to around an inch or two. The genetic contribution that makes up the other twenty inches is—for now—missing in action. It’s the same for heart disease. And schizophrenia. And drug addiction. And Alzheimer’s. And autism. And diabetes. And bipolar disorder. And intelligence. And pretty much any condition, disease, and behavior we have looked at. Genes do not determine the outcome of almost all human biology and psychology. Dozens or hundreds of genes can be involved, each with small cumulative effects, and all mitigated by the world in which we live.
______________________________________________________________________________
Genome
Genome: the totality of your DNA, ~3 billion letters of it.
The Genome is split into ~20,000 genes which are all constructed with DNA. DNA encodes RNA which creates proteins that carry out every single process in the human body.
The genome is the total sum of all genetic material in an organism. Almost all of it is contained within the chromosomes, apart from the little rings of DNA that the cellular powerhouses’ mitochondria hang on to, this betraying their evolutionary origins as bacteria that were annexed into another cell some 2 billion years ago.
~85% of the Genome does not appear to be under any selective pressure at all. Many writers have described the non-coding realm of our DNA as the “dark matter of the genome,” alluding to the stuff we know exists in space, that makes up the majority of mass in the universe, but that we cannot yet account for.
The mitochondrial genome harbors just 37 genes, and the Y chromosome 458. There are around 20,000 genes in humans, and other than those 495 that are exclusive to paternal and maternal lineages, the rest are housed on the autosomes—the 22 pairs of chromosomes inherited from both parents. The source of those is everybody you are descended from, mixed and remixed and shuffled and reshuffled every time a sperm or egg was made in one of your millions of ancestors.
______________________________________________________________________________
Genes
The Genome is split into ~20,000 genes in Humans; have fewer genes than a roundworm. Or a banana. We have roughly the same number of genes as our most useful genetic test species, the mouse, and a few more than our second favorite lab rat, the fruit fly.
The genes of your forebears have very little influence over you. Unless you carry a particular disease that has passed down the family tree.
Admixture: The mixing of genes from populations who were previously separated.
Red Hair: The gene MC1R encodes a pigment in skin and hair; if they have the same rare version on their sixteenth chromosome inherited from both parents, they will have red hair.
Every cell contains every gene, but will only require a handful of genes to be active at any one time. A gene that prompts cell division is no use in a tissue that has finished growing, otherwise it becomes a tumor. A gene that is active in sperm production is not required anywhere other than in a man’s testes. There is a time and place for every gene, especially during the development of an embryo.
Transcription Factors: The foremen of the bodies grand building projects, who look at the map, point to an area, and say “build something there.” The transcription factors themselves are of course encoded in genes, but the switches they activate are not, and there are thousands of them scattered throughout the genome.
Introns: Genes themselves are broken up by other bits of DNA, called introns, which don’t encode proteins either. All human genes are punctuated with introns, and sometimes they are longer than the actual gene itself. It’s a strange thing, to break up a working xxxxxxxxxx text with so many yyyyyy random bits of irrelevant zzzzz guff, and I continually find it impressive that a cell knows to edit it out when going from the basic code of DNA, via the temporary messenger version of the genetic code, RNA, to the fully functional protein.
Pseudogenes: Evolutionary negatively selected and now functionally useless genes.
Genome-wide association study (GWAS): Research at discerning the utility of genes. The points of variation don’t necessarily tell you anything about the cause, only that there is something unusual going on at that spot in the genome. More often than not, GWAS studies return a map with a few, dozens, or even hundreds of flags planted in the ground, and when we send in the investigators, what they find is either nothing of particular note, or lots of small issues that apparently have a cumulative effect.
______________________________________________________________________________
DNA
DNA is a coded alphabet to be translated by the mechanics of a living cell into a protein; all life is made of, or by, proteins.
Exome: the DNA in a genome that encodes actual proteins that perform the jobs of living—constitutes less than 2% of the total amount of DNA that you carry.
Introns: Genes themselves are broken up by other bits of DNA, called introns, which don’t encode proteins either. All human genes are punctuated with introns, and sometimes they are longer than the actual gene itself. It’s a strange thing, to break up a working xxxxxxxxxx text with so many yyyyyy random bits of irrelevant zzzzz guff, and I continually find it impressive that a cell knows to edit it out when going from the basic code of DNA, via the temporary messenger version of the genetic code, RNA, to the fully functional protein.
DNA Sequencing:
1970s: DNA Sequencing; the ability to read DNA was pioneered by the English genius Fred Sanger using a process that copied the original sequence millions of times. To do that, your ingredients need to include the alphabet you’re writing in; DNA consists of only four letters, more formally called nucleotide bases—A, T, C, and G. You also need an enzyme whose job it is simply to copy and link up the bases of DNA, called a polymerase. Throw all these ingredients into a tube and set the temperature right, and the double helix will separate into single strands, which serve as templates to replace the letters that would form the missing strand. You end up with millions of copies of the original template. Each one of the letters of DNA physically links to the one that precedes it and the one that follows.
Sequencing DNA is reconstruction. You make millions of copies that are fragmented at every letter. You then order them by size. DNA is a molecule that carries a negative electrical charge, and this means that if you stick it in some salty water, and put a voltage across that water, the DNA will head toward the positive electrode. The speed at which it migrates is determined by its mass, which is determined by how long that fragment is—a large piece will move more slowly than a small one. So, if instead of putting it in water, you put the DNA in a jellylike gel to slow it down, and run an electric charge across the gel, then the DNA will separate very precisely according to size, just like sieving dirt.
There’s one more trick to this technique. There are only four letters of DNA, unlike the English alphabet’s cumbersome twenty-six. So, take your original gene, and separate it into four tubes. In each of the tubes you add all the ingredients, but in the first you also add some A bases that halt the chain, ones that add the period, but only when there is an A on the template. In the second, you include everything as well as chain-terminating C bases, and so on in tubes three and four, Ts and Gs. After the reactions are complete you have one tube that contains every fragment of DNA that ends with an A, in the second that ends with a C, the third with a T, and the fourth with a G. If you stick these four solutions in four columns on a gel and apply the current, they will be drawn out and separated, and every position of every letter revealed: Your A column will look like this (though the letters would merely be smudges on the gel): *****AA**A*****A******A*A***A* And the T column: **T*T**T**T*T*T*T*T*T****T*T** The C column: C**C****C**C*********C*C**C**C And G: *G***********G***G*G********** If you overlay these four together the asterisks become letters, and you get a complete read: CGTCTAATCATCTGTATGTGTCACATCTAC
Introgression: the introduction of DNA from a separate group over repeated familial backcrosses.
Most fossils from which DNA can be retrieved, only 1% is of the organism itself, the rest being contaminating bacteria that have been feeding off the remains for thousands if not tens of thousands of years.
DNA does not change in a person’s lifetime, unless affected by random mutations from emerging cancers, or caused by attacks from radiation or other mutagens.
______________________________________________________________________________
Proteins
All human proteins are made up from different combinations of 20 amino acids, each of which is encoded in three letters of DNA in a gene.
______________________________________________________________________________
Chromosomes
Autosomes: Chromosomes that are the same as eachother (we have 22 pairs of autosomes).
Sex Chromosomes: The 23rd pair of chromosomes that are different. Men have a Y and an X, whereas women have two Xs. Women get one X from each parent, but men only get their Y chromosomes from their fathers.
______________________________________________________________________________
Human Brain
Serotonin, dopamine, and noradrenaline are the best known neurotransmitters, though there are more than a hundred, and these are some of the molecules that are involved in making us happy or sad, or affected by drug use, or sex, or diseases.
Amygdala: two symmetrical grape-sized parts of the brain known to be involved in emotional responses, decision-making, and memory.
Defects in the amygdala have been associated with fear, aggression, and alcoholism, all of which might appear to line up conveniently with violent criminality.
Brain capacity is one of the key measures in paleoanthropology, and the Neanderthals had bigger ones than us; a modern man’s averages about 1.4 liters by volume, women’s being a little smaller. The Neanderthals range between 1.2 and 1.7 liters. That cranial capacity is not something we can specifically correlate with intellectual capabilities, though in general, in apes, bigger brains mean more sophistication.
______________________________________________________________________________
Sight
Humans are trichromatic—we see in three colors. In the back of our eyes we have photoreceptors, highly specialized cells whose purpose is to literally capture the photons of light that flood through our pupils. There are two classes commonly known as rods and cones: The rods are attuned to pick up movement and low lighting conditions, and they sit in the periphery of the retina, which is why we see indistinct but moving things out of the corners of our eyes. The cones are central, which is why your sharpest color vision is right in front of your eye.
There are three types of cone, each further attuned to a specific wavelength of light, which determines what colors we see. Broadly, they are short, medium, and long wave, but roughly correspond to blue, green, and red, though they overlap in their range, and are subtly variable between people. The difference between each of these cones is down to a single protein called an opsin. The photon passes through your clear cornea and the nucleus-free cells of the lens, through the jelly aqueous, then vitreous humors, through three layers of brain cells, nerves, and blood vessels, and into the very back of the eye where the opsins sit bound into the pointy tips of the cones.* There, the photons are captured by the opsin molecules, which physically jiggle their shape in response, and that molecular shrug triggers an electrical impulse, which shoots out of the other end of the photoreceptor and through the several layers of nerve cells, which collectively bundle their nerve fibers into the optic nerve, into the visual cortex of the brain, and this is how you see.
______________________________________________________________________________
Smell
We don’t really understand how smell works. In our noses there are cells that are triggered when particular molecules float onto them. We capture airborne whiffs with proteins called olfactory receptors, which sit astride the membrane of the neurons in our noses that wire directly to the brain. They’re very similar to the proteins in our rods and cones in our retina that trigger vision, but instead of being stimulated by photons of light, they fire their signal after trapping odorous chemicals, and thus begins the perception of smell. Unlike with vision, there are many types of olfactory receptors and each one seems to capture a range of smelly molecules. To complicate matters even more, each smelly molecule seems to stimulate multiple receptors.
We have around 400 olfactory genes, ones that relate to smells, and these combine in myriad ways to create the rich smellscape that we enjoy.
______________________________________________________________________________
Race
From the point of view of a geneticist, race does not exist. It has no useful scientific value.
Genetically, two black people are more likely to be more different to each other than a black person and a white person.
Skin Color generally comes down to the density and type of melanin that you produce. Specialist cells called melanocytes sit at the base of the skin, and produce melanin following exposure to ultraviolet light from the sun. The melanin collects in little specialized pockets called melanosomes, which shuffle between cells, which is why people tan in the sun. They move into position atop the cell nucleus as a means of protecting the DNA within from UV damage, which can slice through the double helix with abandon. In hair follicles, the melanocytes transfer the melanosomes into the base of the growing hair, and that is how your hair is colored. There are two types of melanin:
Eumelanin: Black or brown.
Phaeomelanin: Reddish and is the root of ginger hair.
There are no essential genetic elements for any particular group of people who might be identified as a “race.” As far as genetics is concerned, race does not exist.
Black is virtually meaningless as a scientific descriptor, and Africa as a racial group is also of very limited use because black people are more likely to be more genetically different from each other than they are from white people.
There is no single gene that underpins the concept of race, just like there are so few genes for any one complex human characteristic, and there are just a few that convey the broad physical differences that render populations very visibly different from each other.
His team sampled SNPs from 1,056 people, from 52 geographic regions, and looked at variations at 377 locations spread across the whole 3 billion letters of each of their genomes. This was a huge study at the time, and though 377 dots in an ocean of 3 billion sounds like a drop, that is plenty enough to determine the spread across nations. They fed this data into a computer program called STRUCTURE that sorts for similarities by clusters—plug the numbers in and then ask it to sort them into a number of categories that you decide. They asked it to give out a range of clusters from two to six—that is, divided into two groups of people based on similarities, then three, four, and so on. When they did two, it grouped all people into those from Africa, Europe, and western Asia, and those from eastern Asia, the Americas, and Australia. That makes sense; these geographically are the places that we populated first. When asking the algorithm for three groups, Africa is hived off as a separate group. That also makes sense; the people who went out of Africa were only a small sample of the total available alleles. With five groupings, Australia becomes a separate group, as does eastern Asia. All of a sudden, the genetics appears to confirm the most traditional racial grouping: African, Europeans and the Middle East, East Asians, Australians, and the Americas. The graphical representations of these types of data show blending at the edges. The sharpest delineations coincide with water: Europe, sub-Saharan Africa, and East Asia. But with the addition of more groups, with fewer oceanic gulfs, human variation is pretty continuous. The concept of a discrete or pure race vanishes in the haze.
One of the most persistent misconception is the idea that black people have a higher proportion of “fast twitch” muscle fibers, a type of subcellular protein that is involved with explosive movement. That a Namibian and a Nigerian have more similar skin color than either do to a Swede masks the fact that the majority of their genes are more dissimilar to each other than they are to that same Swede. So if the main classifier is skin color, the differences that underlie dark skin are too great to support an argument of generic athletic superiority. A particular version of the gene alpha-actinin-3, which is associated with the fast-twitch muscle fiber, is present in successful black sprinters, but is not exclusive to Africans, or indeed any particular regional or cultural group within Africa. The idea that black people are better at sport because of genetics, and possibly because of breeding during the wicked centuries of slavery, is built upon tissue foundations, and its cultural ubiquity yet another example of the chasm between what we think, and what science says is true.
______________________________________________________________________________
Genetic Disorders
Down Syndrome: Caused by having three copies of chromosome 21 instead of the normal pair.
Turner’s Syndrome: A female disorder with a suite of physical and reproductive problems—is a result of a woman missing a second X.
Klinefelter’s Syndrome: When a man has an extra X (XXY).
XYY Syndrome: When a man has an extra Y (XYY).
Lactose Intolerance: The absence of lactase, or its reduced activity, means that the lactose doesn’t get digested in the small intestine, so it passes into the colon, where it encounters bacteria that can break it down and it ferments, causing gas buildup. That’s the direct cause of the bloating and fartiness, but also the increased pressure triggers diarrhea, and so on.
Celiac Disease: a form of irritable bowel sensitivity (IBS) to the wheat protein gluten.
Inbreeding: the failure to add genetic variation to a child because of mating with someone closely related.
A first cousin marriage almost doubles the risk of a recessive disease emerging, compared to non-consanguineous parents. But the numbers are low to start with. The probability overall for non-related couples having a child bearing a recessive disease is around 2-3%. For first cousins it’s around 5%. This, by the way, is about the same as for a couple where the woman is over 41.
Sickle Cell Anemia: Genetic mutations emerged in populations in malaria regions that offer some protection against two versions of the disease, caused by the single-celled parasites Plasmodium falciparum and Plasmodium vivax. An alteration in the gene hemoglobin-B causes a structural change to the shape of blood cells, normally a half-sucked lozenge, which becomes rigid and curved like the blade of a sickle. People with one copy of the mutated gene have sickle cell trait: Their blood contains some of the distorted blood cells, but they are largely unaffected. People with two copies have sickle cell anemia, a serious disease that 300,000 children are born with every year, with symptoms including pain, infections, and increased risk of stroke, and death, all because the misshapen blood cells can get lodged in blood vessels and organs. But sickle cell trait offers protection against infection from malaria.
Tay-Sachs: A recessive disease caused by mutations in the HEXA gene. It’s a terrible syndrome in which the brain deteriorates over a short time in very young children, and they die soon.
Hemophilia: where boys are unable to form blood clots easily, and are thus at extreme risk of bleeding to death. It was one of the first diseases to be understood in terms of its genetic cause, in 1989, a condition caused by a single gene on the X chromosome (thus only affecting men; women carrying a defective allele are compensated by their second X).
All studies so far have shown that many genes of small effect play a very small role in the diagnosis of any of them. That is a very typical statement when it comes to complex psychiatric disorders. There is no gene for any one of them, and any association found is weak. Furthermore, there is no known association between any one of those disorders and violent crime.
______________________________________________________________________________
Religion
Dogma: an incontrovertible belief laid down without evidence by an authority.
Creationists (and others unencumbered by facts).
Christianity, frothing with risible fallacies.
This is how astrology works—divination drawn from banality, that we are complicit in. We cling to the things that appeal, and happily ignore the rest.
______________________________________________________________________________
Chronology
Oct, 2015: 47 Modern Teeth aged from 80ka are discovered in the Fuyan cave in the Daoxian region in southern China.-Brief History by Rutherford.
2013: Software writers Sad Engineers Studios created Íslendinga-App- effectively a database of most of the people who have ever been recorded as having lived in Iceland, drawing its data from the Íslendingabók genealogical library built from records dating back more than 1,000 years. Two users can link their apps on their smartphones together to see how they are related, and genealogical proximity sets off the Sifjaspellsspillir alarm—the incest spoiler.-Brief History by Rutherford.
2003: Researcher Chang concludes that the most recent common ancestor of everyone alive today on Earth lived only around 3,400 years ago. The computer calculates when lines of ancestry cross, and the number comes out at around 1400 BCE. It places that person somewhere in Asia.-Brief History by Rutherford.
2003: Discovery of Homo floriensis (Hobbits) on the Indonesian Isle of Flores; the skeletal remains of a meter-high female, and parts of at least eight other people were unearthed in a cave called Liang Bua. They appear to have lived in this humid cave as recently as 13,000 Ka, which is only a few centuries before the beginning of farming. These tiny people cooked with fire, and probably butchered meat of giant rats and stegodons (a species of tiny elephant) that lived alongside them.-Brief History by Rutherford.
Jun, 1997: J. K. Rowling introduces the world to Harry Potter.-Brief History by Rutherford.
1997: Paleogenetics is founded by Svante Pääbo; borrowing the right humerus, the bone between the elbow and the shoulder, of Neanderthal 1 from Rheinisches Landesmuseum Bonn.-Brief History by Rutherford.
1989: Hemophilia’s genetic link is discovered; where boys are unable to form blood clots easily, and are thus at extreme risk of bleeding to death; one of the first diseases to be understood in terms of its genetic cause, a condition caused by a single gene on the X chromosome (thus only affecting men; women carrying a defective allele are compensated by their second X).-Brief History by Rutherford.
1974: Discovery of “Lucy”; 40% of her fossilized skeleton is discovered in by Donald Johanson, and named after the Beatles song “Lucy in the Sky with Diamonds” that was playing back at the researcher’s base camp in the Awash Valley in Ethiopia. Lucy was one of the first members of the species Australopithecus afarensis discovered.-Brief History by Rutherford.
1970s: DNA Sequencing; the ability to read DNA is pioneered by English genius Fred Sanger using a process that copies the original sequence millions of times.-Brief History by Rutherford.
1960s: Genomic Scientists discern that DNA encodes proteins, and that all life is built of, or by, proteins.-Brief History by Rutherford.
1956: Francis Crick names the core kernel of molecular biology the ‘central dogma’- the idea that DNA encodes RNA that translates into proteins.-Brief History by Rutherford.
17-25 Sep, 1944: Operation Market Garden; the Allies attempt to enter Germany from across the Rhine.-Brief History by Rutherford.
1942: UK Prime Minister Clement Atlee introduces the British Welfare State in the 1942 Bevridge Report.-Brief History by Rutherford.
1948: The British National Health Service (NHS) introduces free healthcare to all UK citizens.-Brief History by Rutherford.
1914-1918: WWI; Blood groups began to be established into the A, B, O system we still use today during WWI.-Brief History by Rutherford.
1894: Yersinia is discovered by Swiss-French bacteriologist Alexandre Yersin.-Brief History by Rutherford.
1880s: Discovery of Tay-Sachs Disease, independently by two doctors. In London, Waren Tay had spotted red dots in the retina of young children from a single Jewish family, and followed the disease progression through gradual nerve deterioration and death. Bernard Sachs also saw similar symptoms in New York, and proposed a name: amaurotic familial idiocy. The disease they were both seeing is now called Tay-Sachs and is well understood as a recessive disease caused by mutations in the HEXA gene. It’s a terrible syndrome in which the brain deteriorates over a short time in very young children, and they die soon.-Brief History by Rutherford.
1871: Darwin publishes the Descent of Man; his primary concern was the question of whether man, like every other species, is descended from some pre-existing form. With great, possibly typical, prescience, he also acknowledged that those characters of race in manhood were neither permanent, nor quintessential: It may be doubted whether any character can be named which is distinctive of a race and is constant.-Brief History by Rutherford.
1863: POTUS Lincoln issues the Emancipation Proclamation; a federal mandate to change the legal status of slaves to free.-Brief History by Rutherford.
1830: POTUS Andrew Jackson signs the Indian Removal Act into law giving the federal government the right to negotiate relocation of certain southern tribes of the Cherokee Nation. Though discussions were technically voluntary, enormous pressure was put on the tribal chiefs to relocate away from their own lands. This preceded the forced removal of other tribes, known as the Trail of Tears. Following the discovery of gold in Cherokee territory, more than 16,000 were forcibly moved, and though the numbers are uncertain, many thousands of Native Americans died en route.-Brief History by Rutherford.
1807: The UK bans slavery when William Wilberforce drives the Abolition of the Slave Trade Act through Parliament in 1807.-Brief History by Rutherford.
1833: Slavery is banned in the entirety of the UK Empire.-Brief History by Rutherford.
1492: Columbus makes landfall in the Caribbean. There he met locals, who became generically known to the Spaniards as indios—Indians—because Columbus thought he had reached the East Indies.-Brief History by Rutherford.
1348-1350: Yersinia Pestis, arrived from China, decimates Eurasia for a second time killing a third of the population. Over a 5y period we can track a course from Russia to Constantinople, to Messina, to Genoa, Marseille, Bordeaux, and finally London. All these ports acted as points from which radiation of the plague could crawl inland. En route, it claimed the lives of some 5M people.-Brief History by Rutherford.
11c: The Roma (‘Gypsies’) migrate on several occasions to Europe from NW India.-Brief History by Rutherford.
1004: The Vikings Vinland colony in North America; Thorfinn Karlsefni and Gudrid Thorbjarnardóttir are among the first immigrant party to North America where they have a son, Snorri Thorfinnsson, born in Vinland, and the first person of European ancestry to enter the world in the Americas. There were constant skirmishes between the Vikings and the Skraeling, and after a scuffle prompted by a loose rampaging Viking bull, the Norsemen decided that though the land might be choice and good, there would be always war and terror overhanging them, from those who dwelt there before them.-Brief History by Rutherford.
874: Ingólfur Arnarson and his family arrive in Iceland, taking their place as the first permanent residents in the southwest fjords, a place he called Reykjavík—the Bay of Smokes. Other settlers followed that year.-Brief History by Rutherford.
800: Charlemagne is crowned the first Holy Roman Emperor by Pope Leo III in St Peter’s Basilica, an event so momentous that Charlemagne marked it by giving Leo one of the great medieval relics as a thank you—the Holy Prepuce, better known as Jesus’ foreskin.-Brief History by Rutherford.
541: Yersinia Pestis, arrived from China, decimates Eurasia; the epicenter of the infection being Constantinople, ruled as the Byzantine Empire under Justinian. The pandemic kills ~25M people across Europe, Asia, and Africa.-Brief History by Rutherford.
Historians speculate that the obliteration of so many souls over the waves that followed for the next two centuries made significant contributions to the end of Rome’s rule, and plague-weakened armies opened the door to people of the Middle East.-Brief History by Rutherford.
500: The first wave of Roma (‘Gypsies’) arrive in Europe from NW India. They migrate through to the Balkans, and disperse via Bulgaria around the 11c.-Brief History by Rutherford.
1400 BCE: The Most common ancestor of every human alive today lives on Earth.-Brief History by Rutherford.
4 Ka: Writing begins in Mesopotamia.-Brief History by Rutherford.
30,000 BCE: The Western Beringian peoples living near the Yana River in Siberia are the first to cross the Bering Strait.-Brief History by Rutherford.
30,000 BCE-11,000 BCE: The Last Glacial Maximum; the earth is subjected to a cold snap that sucks up the sea into glaciers and ice sheets extending from the Poles. The reach of the most recent Ice Age was at its fullest. Sea level was somewhere between 60-120m lower than today.-Brief History by Rutherford.
100 Ka: There are no Homo sapiens anywhere on Earth apart from in Africa, as far as we know.
300 Ka: Humans are cooking food with fire.-Brief History by Rutherford.
300 Ka: The species Homo sapiens emerges in pockets in the east and north of Africa.-Brief History by Rutherford.
400 Ka: The Neanderthals and Sapien lineage moves apart.-Brief History by Rutherford.
3.2 Ma: The famous "Lucy" walks the Earth. 40% of her fossilized skeleton (which is a lot to be preserved for remains that old) was discovered in 1974 by Donald Johanson, and named after the Beatles song “Lucy in the Sky with Diamonds” that was playing back at the researcher’s base camp in the Awash Valley in Ethiopia. Lucy was one of the first members of the species Australopithecus afarensis discovered.-Brief History by Rutherford.
4 Ma: Bipedal Apes walk the Earth; standing upright was a quintessential step in our own evolution, as it prompted and coincided with a number of anatomical changes, such as the position and shape of the spine, how it connects to the skull, and so on.-Brief History by Rutherford.
6 Ma: Hominids (Homo) split from the Chimpanzee lineage.-Brief History by Rutherford.
______________________________________________________________________________